What is Microsatellite Instability?

Source: Shutterstock.
Colorectal cancer, the third most common cancer worldwide, has many causes. While some of these are external and a result of our diet or lifestyle, others originate from within the body itself. In many cases of colorectal cancer, however, it is a combination of risk factors and other causes that lead to the formation of cancerous growth in the colon. As such, it often is difficult to identify the exact cause of the cancer.
Nonetheless, years of research have helped us to identify different characteristics (or biomarkers) that are associated with colorectal cancer. Of the different biomarkers, microsatellite instability or MSI has been identified as a way to determine the type of colorectal cancer a patient is carrying.
In this article, we delve deeper into what MSI is and how it impacts colorectal cancer detection, diagnosis and treatment.
What are microsatellites?
Microsatellites are short stretches of DNA that contain repeating units of one to five (or more) nucleotides. The nucleotides adenine (A), thymine (T), guanine (G) and cytosine (C) are found in repeated, adjacent patterns in microsatellites, and the repetitive motif can consist of one to five (or more) nucleotides. These motifs can be found repeated between 5–50 times consecutively.
Number of nucleotides | Microsatellite | Example |
|---|---|---|
1 | Mononucleotide microsatellite | TTTTTTT |
2 | Dinucleotide microsatellite | TATATATATATATATATATATATATATATATATATA |
3 | Trinucleotide microsatellite | GTCGTCGTCGTCGTCGTCGTCGTCGTCGTCGTC |
4 | Tetranucleotide microsatellite | CAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGT |
5 | Pentanucleotide microsatellite | ATCGTATCGTATCGTATCGTATCGTATCGT |
Microsatellite motifs can come in any combination of nucleotides, and these are scattered throughout the genome. They are prone to mutations, and as a result, are highly polymorphic (coming in many different forms).
What is microsatellite instability?
DNA mismatch repair (MMR) genes, including MLH1, MSH2, MSH6 and PMS2, are responsible for repairing errors that occur during DNA replication. When these genes are mutated or dysfunctional, they are unable to repair errors that occur in genomic DNA. When microsatellites undergo mutations due to deficiency in MMR proteins, the length of the repeated sequence can be altered, resulting in a condition known as microsatellite instability (MSI).
A defective MMR can also lead to mutations in the normal functioning of genes that are involved in the regulation of cell growth and division. When genes that normally inhibit cell growth are disrupted, cells can begin to divide uncontrollably.
Affected genes include tumor suppressors adenomatous polyposis coli (APC), K-ras and p53. A defective MMR can also result in the inactivation of a gene encoding TGF-βRII, another key regulator of cell growth and differentiation. Loss of TGF-βRII function can lead to increased cell division and the formation of tumors.
The function of MMR genes is compromised by mutations within MMR genes, which can be inherited through families, leading to a condition known as Lynch syndrome or hereditary nonpolyposis colorectal cancer (HNPCC). Alternatively, the MLH1 may be switched off due to a process called DNA promoter methylation.
Microsatellite instability and colorectal cancer
Colorectal tumors with MSI status are a distinct subtype of colorectal cancer. These tumors are characterized by specific genetic and molecular features, such as mutations in MMR genes and other genes involved in DNA repair.
As it stands, MSI is a major predictive and diagnostic marker for colorectal cancer. Detecting MSI can be done through genetic testing, and is crucial in screening for Lynch syndrome, a hereditary genetic condition that predisposes a patient to colorectal cancer.
They are also associated with a distinct pattern of gene expression and clinical features, such as early age of onset and a tendency to occur on the right side of the colon. Tumors that form in the right-side are typically either sessile serrated adenomas or mucinous adenocarcinomas — malignant tumors that originate from the epithelial lining and result in abnormal mucous secretion. In general, the tumors appear more flat morphologically.
The diagnosis of MSI in colorectal tumors is important because it has important implications for patient management and prognosis. MSI tumors are generally associated with a better prognosis than non-MSI tumors, such as high chromosome instability (CIN) tumors. If mutations in MMR genes are found to be transmitted within a family, regular cancer screening is recommended for family members carrying these MMR gene mutations.
Patients with MSI tumors tend to respond better to immunotherapies than traditional chemotherapy treatments. The immune system’s T cells can identify abnormal cells within the body. They recognize proteins that are expressed only in cancer cells and not in normal cells. When a molecule called PD-L1 on the surface of cancer cells binds with another molecule called PD-1 on the surface of T cells, the T cells cannot attack and eliminate the cancer cells even if they recognize them. Cancer cells use the expression of PD-L1 to escape from the immune system. In MSI colorectal cancer, there are more proteins derived from mutated genes than in other types of cancers. Antigens derived from mutated proteins, which are called neoantigens, were presented on major histocompatibility complex (MHC) class I molecules, and attract T cells into the tumor microenvironment.
Tumors resulting from high MSI have been found to have an upregulation of immune checkpoint proteins such as programmed death-ligand 1 (PD-L1) compared to other types of cancers. The interaction between the T-cell receptors with the MHC molecules, coupled with the addition of checkpoint protein inhibitors that block PD-1 and PD-L1 allows T-cells to recognize cancerous cells and activate programmed death, eliciting a more effective response in treatment.
On the other hand, when tumor cells present fewer neoantigens on the cell surface and thus escape recognition by T cells, the immune response against the tumor is not as effective. This is particularly applicable to non-high MSI tumor cells, which exhibit a limited response to immunotherapy treatments.
As such, screening for and detecting MSI in colorectal cancer patients is key in ensuring that patients are able to receive the appropriate type of treatment, while also minimizing the risk of side effects that result from ineffective treatment methods.
